CHTKC software documentation
CHTKC is a k-mer counting software written in C language. It is based on a lock-free hash table which uses chaining to resolve collisions.
Installation
The latest release of CHTKC source code can be downloaded from github.
To compile CHTKC, please ensure zlib (to support gzip-compressed inputs) and cmake (version 3.0.2 or higher) are installed on the target system.
The source code can be compiled using:
mkdir build
cd build
cmake ..
make
The build directory will contain two versions of CHTKC binary files:
chtkc: normal version.chtkco: optimized version.
Note
Under small RAM usage, chtkco has better performance, because it can allocate more nodes than chtkc. However, chtkco can only use up to 4G (4294967295) nodes, when the available memory is big enough, chtkc may instead allocate more nodes than chtkco. For example, when counting 28-mers, if the RAM usage is over 150 GB, please consider using chtkc.
Installation on macOS
If you compile CHTKC on macOS, since CHTKC currently uses the argp library to parse arguments, and the library is usually not installed on macOS, it must be installed manually before compilation.
One possible workaround is to install argp-standalone using Homebrew, please run these commands before compiling.:
# Install Homebrew.
/bin/bash -c "$(curl -fsSL https://raw.githubusercontent.com/Homebrew/install/master/install.sh)"
# Use Homebrew to install argp-standalone.
brew install argp-standalone
# Manually update compiling flags.
export CFLAGS="$CFLAGS -I/usr/local/include"
export LDFLAGS="$LDFLAGS -L/usr/local/lib/ -largp"
Usage
chtkc and chtkco share the same usage, take chtkc for example, the basic usage is as follows:
chtkc <CMD> [OPTION...] ARGS...
Currently, chtkc supports three subcommands, <CMD> can be count, histo or dump.
Couting k-mers
chtkc count is the command to do k-mer counting, the usage is as follows:
chtkc count [OPTION...] FILE...
-k, --kmer-len- the length of k-mer.-m, --mem- The memory size to be used during the k-mer counting process. In bytes, can be specified usingM/Gfor convenient.-o, --out- The path of output file.-t, --threads- The number of threads to be used.--fa- Specify the input files are inFASTAformat, cannot be used with--fq.--fq- Specify the input files are inFASTQformat, cannot be used with--fa.--gz- Specify the input aregzipcompressed files.--count-max- The maximum k-mer frequency value when counting, frequencies larger than this value will be recorded as this value.Default: 255--filter-max- K-mers with frequency larger than this value will not be exported into the final result.--filter-min- K-mers with frequency smaller than this value will not be exported into the final result.Default: 2--log- The path of the log file.--bs- The size of read buffers, increasing the value (over 5000000) can improve the performance when countinggzipfiles, in bytes.--rt- The number of reading threads, this can be considered to be used when counting for multiplegzipinput files.-?, --help- Print the usage ofchtkc.
Generate histogram for k-mer counting results
chtkc histo produces a file containing the number of k-mers for each frequency value, the usage is as follows:
chtkc histo [OPTION...] RESULT
-o, --outThe path of the output file.
Output ASCII format of k-mer counting results
chtkc dump outputs the ASCII format of the k-mer counting results, the usage is as follows:
chtkc dump [OPTION...] RESULT
-o, --outThe path of the output file.
Examples
An example dataset can be downloaded here, and some usage examples are as follows:
chtkc count -k 28 -m 500M --fq -o result test.fq
chtkc count -k 55 -m 50G -t 16 --fq -o result --filter-min=1 test.fq --log=test.log
chtkc count -k 28 -m 500M --fq --gz -o result test.fq.gz
chtkc histo -o histo.txt result
chtkc dump -o result.txt result
Output
chtkc count outputs a binary file as result, containing each k-mer and its frequency.
The output file contains a 32 bytes header recording basic counting parameters, the k-mer and frequency information comes after the header. All the <k-mer, frequency> pair are concatenated with each other.
The occupation space of a <k-mer, frequency> pair is determined by the length of k-mer and the maximum count value (specified by --count-max option). A, C, G and T are encoded as 00, 01, 10 and 11. Either the k-mer sequence and its frequency is encoded in Little-endian format. For example:
-
If counting for 21-mers (
--count-max=255),CTCGAACGCCGATTAATGGCC: 35is stored as10100101 11000011 01100011 00011001 11011000 00000001 00100011(The last byte stores the frequency value). -
If counting for 41-mers (
--count-max=255),CTCGAACGCCGATTAATGGTTTGCAGGTGCCCATGTTTGAA: 35is stored as11100000 11101111 01010100 10101110 11100100 10101111 11000011 01100011 00011001 11011000 00000001 00100011(The last byte stores the frequency value). -
If counting for 41-mers (
--count-max=400),CTCGAACGCCGATTAATGGTTTGCAGGTGCCCATGTTTGAA: 335is stored as11100000 11101111 01010100 10101110 11100100 10101111 11000011 01100011 00011001 11011000 00000001 01001111 00000001(The last two byte store the frequency value).